BIOL1181 2250 Assignment 1: Applied Theory (WEEKS 1-3)

In order to target a specific region of genomic DNA with CRISPR, researchers must include a guide RNA containing a 20-basepair (bp) long spacer sequence that matches the DNA sequence at the target site. One of the possible risks of genetic engineering methods is "off-target" editing, which occurs when a guide RNA matches a part of the genome other than the intended target site. (i) How many possible guide RNA sequences are there? (ii) Estimate probability that a single site in the human genome matches a random 20-bp spacer. State all your assumptions. (iii) After infection, HIV converts its RNA genome into DNA and inserts itself into the human genome. Imagine you have designed a 20-bp spacer to target and deactivate part of the HIV DNA sequence. Based on the previous answer, estimate the probability that this sequence will have at least one off-target match somewhere in the human X chromosome, which is 300 000 bp long (counting both strands). Note: when P is very small (close to 0), (1-P)^n is approximately equal to (1-nP). (iv) What would be the probability of an off-target site appearing somewhere in the entire human genome (6 billion pairs counting both strands)?

3. The recognition cutting sites of 2 different enzymes (enzymes A: blue star; enzyme B: red triangle) are shown in the map below. In your answer include: a) A prediction of the size (in bp) of the resulting fragments after digestion of the amplicon with the two enzymes mixed together (Mix), when each enzyme is used separately (A and B) and when no enzyme (NO) is used. b) A drawing of these fragments onto the graph below to represent a gel electrophoresis. You can either recreate the picture e.g. in PowerPoint/paint/others and then paste this in your research paper or print this, draw on it, and take a picture of it and then upload this on the research paper. Doesn't need to be perfect but the bands size difference MUST be clear.

Consider the tree below that was obtained by doing the Growing Tree exercise. Which traits do you expect to differ between the flowers on Peak 4 and those of the common ancestor of all populations? Select all that apply. stripes spur length petal tips spur colour anthers blade colour stigmas petal colour

In the Tree Building Challenge exercise, please use the following steps to build a tree. Identify which tree of the options below is the one that you constructed. 1. Start on Peak 1. Reset the simulation until you get to this starting point. 2. Let some time pass. 3. Move a flower from Peak 1 to Peak 3 4. Let some time pass. 5. Move a flower from Peak 3 to Peak 4 6. Let some time pass. 7. Move a flower from Peak 1 to Peak 2. 8. Let some time pass.

In the columbine tree, what do branch lengths represent? the branch lengths arbitrary (they do not represent anything)are the branch lengths correspond to the number of mutations that have occurred the branch lengths correspond to time the branch lengths correspond to the number of seeds that established a new population

2. Given the below DNA sequence and the given Forward primer sequence (highlighted in yellow), design the reverse primer sequence (of a 20bp length) that you would have to purchase if you want to generate a 876bp amplicon. GCACAGGATACTCCAACCTGCCTGCCCCCATGGTCTCATCCTCCTGCTTCTGGGACCTCCTGATCCTGCCCCTGGTG CTAAGAGGCAGGTAAGGGGCTGCAGGCAGCAGGGCTCGGAGCCCATGCCCCCTCACCATGGGTCAGGCTGGACCTCC AGGTGCCTGTTCTGGGGAGCTGGGAGGGCCGGAGGGGTGTACCCCAGGGGCTCAGCCCAGATGACACTATGGGGGTG ATGGTGTCATGGGACCTGGCCAGGAGAGGGGAGATGGGCTCCCAGAAGAGGAGTGGGGGCTGAGAGGGTGCCTGGGG GGCCAGGACGGAGCTGGGCCAGTGCACAGCTTCCCACACCTGCCCACCCCCAGAGTCCTGCCGCCACCCCCAGATCA CACGGAAGATGAGGTCCGAGTGGCCTGCTGAGGACTTGCTGCTTGTCCCCAGGTCCCCAGGTCATGCCCTCCTTCTG CCACCCTGGGGAGCTGAGGGCCTCAGCTGGGGCTGCTGTCCTAAGGCAGGGTGGGAACTAGGCAGCCAGCAGGGAGG GGACCCCTCCCTCACTCCCACTCTCCCACCCCCACCACCTTGGCCCATCCATGGCGGCATCTTGGGCCATCCGGGAC TGGGGACAGGGGTCCTGGGGACAGGGGTCCGGGGACAGGGTCCTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGA CAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTCCGGGGACAGGGGT GTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGA CAGGGGTCCTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGG TCCTGGGGATAGGGG

a). Choose a specific ecosystem (eg a coral reef, a desert, a rainforest) and briefly describe a situation where human intervention has significantly altered it (either for the better or the worse). Remember to describe the ecosystem both before and after the changes and explain the factors that have caused the transformation (examples would include logging companies clearing large areas of forest or the introduction of a treatment plant that reduced the amount of raw sewage piped into the sea).

Consider the three trees below. One of them has different evolutionary relationships among the four peaks than the other two. Which one is it? Tree A Tree BC' Tree C

Part I: Learning about molecular phylogenies 1. What is the basic assumption underlying a molecular phylogeny? Why must we distinguish between gene trees and species trees? 2. 3. Why don't genes always evolve by a series of bifurcations (i.e., by a series of single base changes)? 4. What are the four steps to constructing a molecular phylogeny? 5. What is an orthologous sequence? 6. What is a paralogous sequence? 7. What is a xenologous sequence? 8. Which type of sequences should you use for a species phylogeny? 9. What is the difference between multiple sequence alignments to discover motifs, etc., vs for constructing phylogenies? 10. Why is Clustal W not a very good choice for constructing species phylogenies?/n10. Why is Clustal W not a very good choice for constructing species phylogenies? 11. Please use the supplemental material on the links page to answer the following questions. What is a phylogenetic tree composed of? What is the difference between rooted and unrooted phylogenetic trees? What are the two major groups of analyses used to examine phylogenetic relationships? 0 0 0 What is a paraphyletic grouping? What happens if a multiple alignment is poor? What is the best way to deal with parts of an alignment that are uncertain due to gaps? What sorts of phylogenies are best constructed using DNA sequence alignments? What sorts of phylogenies are best constructed using protein alignments? What sorts of phylogenies are best constructed using ribosomal RNA sequence alignments? 0 0 0 0 0 What is a homoplasy? 0 Why can't we simply construct all possible trees, score each one, then pick the one with the best score? 0

Your classmate says that when they ran their simulation,anthers were the first trait to mutate (from white to yellow).When you tell your classmate that in your tree the anthers did not mutate after 800 years, they indicate that they think you did something wrong. What would you tell your classmate?Choose the answer that best fits this situation. "You are right. All of the mutations should show up within 800 years." "Hmmm. I guess I did do something wrong. My tree should be the same as yours." "Every simulation is different, and the mutations arise at random. It is completely possible that another colour might not mutate at all."